View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19105_high_21 (Length: 260)
Name: NF19105_high_21
Description: NF19105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19105_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 42222331 - 42222095
Alignment:
| Q |
11 |
cagagacagtggtcttatggtggtagggggatgttggttcaatttgagagaaggtttagaaaaaacaagtaaataccaacccggtttgattctttacaac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42222331 |
cagacacagtggtcttatggtggtagggggatgttggttcaatttgagagaaggtttagaaaaaacaagtaaataccaacccggtttgattctttacaac |
42222232 |
T |
|
| Q |
111 |
caacgtttgattcaaattctattcagatgagactaattggcgttgcattattgcatgggctgacgcaccccaccaattcaagtttctaa-nnnnnnnnnn |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42222231 |
caacgtttgattcaaattctatacagatgagattaattggcgttgcattattgcatgggctgacgcaccccaccaattcaagtttctaattttttttttc |
42222132 |
T |
|
| Q |
210 |
nncatgtgaagacaaatggttttgcagtcaatttatt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42222131 |
ttcatgtgaagacaaatggttttgcagtcaatttatt |
42222095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 42872458 - 42872422
Alignment:
| Q |
152 |
gttgcattattgcatgggctgacgcaccccaccaatt |
188 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42872458 |
gttgcactattgcatgggctgacgcaccccaccaatt |
42872422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 194
Target Start/End: Original strand, 8992298 - 8992340
Alignment:
| Q |
152 |
gttgcattattgcatgggctgacgcaccccaccaattcaagtt |
194 |
Q |
| |
|
|||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8992298 |
gttgcactattgcatgggctggcgcacccctccaattcaagtt |
8992340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 8973476 - 8973520
Alignment:
| Q |
150 |
gcgttgcattattgcatgggctgacgcaccccaccaattcaagtt |
194 |
Q |
| |
|
|||||||| ||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
8973476 |
gcgttgcactattgcatgagctggcgcgccccaccaattcaagtt |
8973520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 11652334 - 11652298
Alignment:
| Q |
152 |
gttgcattattgcatgggctgacgcaccccaccaatt |
188 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11652334 |
gttgcactattgcatgggctggcgcaccccaccaatt |
11652298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 190
Target Start/End: Complemental strand, 26984612 - 26984572
Alignment:
| Q |
150 |
gcgttgcattattgcatgggctgacgcaccccaccaattca |
190 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
26984612 |
gcgttgcactattgcatgggctggcgcatcccaccaattca |
26984572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University