View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19105_high_24 (Length: 247)
Name: NF19105_high_24
Description: NF19105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19105_high_24 |
 | |
|
| [»] scaffold0449 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 3183 - 2966
Alignment:
| Q |
13 |
aatatagatcaagttatgatgtttgaggagtcaactatgaaatgggagacttttcagaatttgtgtttgagatttaactaactttcctttcacttttcct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3183 |
aatatagatcaagttatgatgtttgaggagtcaactatgaaatgggagacttttcagaatttgtgtttgagatttaactaactttcctttcacttttcct |
3084 |
T |
|
| Q |
113 |
attacactataaatagattaatgaagtaccattagtaattcatttaaagttgtctatcatatcaggcaggcaggccctcatattctatagctacagggaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3083 |
attacactataaatagattaatgaagtaccattagtaattcatttaaagttgtctatcatatcaggcaggcaggccctcatattctatagctacggggaa |
2984 |
T |
|
| Q |
213 |
cgtgtaaccctcctattc |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2983 |
cgtgtaaccctcctattc |
2966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University