View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19105_high_28 (Length: 235)
Name: NF19105_high_28
Description: NF19105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19105_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 33301256 - 33301043
Alignment:
| Q |
9 |
aacagagaggaaaatgttgtcctgaccgattatgttagcaaaatttgatgtgtaaagtttgtctgtcactgctgaaccaggatttgccagaacaagctgc |
108 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33301256 |
aacagtgaggaaaatgttgtcctgaccaattatgttagcaaaatttgatgtgtaaagtttgtctgtcactgctgaaccaggatttgccagaacaagctgc |
33301157 |
T |
|
| Q |
109 |
tcaaacaagtaacgcattcttggtaagaattaacatattaacttgtcctatcatatagtatcatgatttatatcatatagtctataaatgaaccaagctt |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33301156 |
tcaaacaagtaacacattcttggtaagaattaacatattaacttttcctatcatatagtatcatgatttatatcatatagtatataaatgaaccaagctt |
33301057 |
T |
|
| Q |
209 |
cttcatatacataa |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33301056 |
cttcatatacataa |
33301043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 112
Target Start/End: Complemental strand, 25723235 - 25723169
Alignment:
| Q |
46 |
gcaaaatttgatgtgtaaagtttgtctgtcactgctgaaccaggatttgccagaacaagctgctcaa |
112 |
Q |
| |
|
||||| || ||||||| ||||||||| ||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
25723235 |
gcaaagttggatgtgtggagtttgtctatcactagtggaccaggatttgcaagaacaagctgctcaa |
25723169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University