View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19106_high_23 (Length: 234)
Name: NF19106_high_23
Description: NF19106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19106_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 4074960 - 4074772
Alignment:
| Q |
1 |
cagtagttagatccaaaatattcttgttagagccctttagtcaacaagtctttaaaatcttttaaaaaattgttcgacaaagttttacgttaactctaat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4074960 |
cagtagttggatccaaaatattcttgttagagccctttagtcaacaagtctttaaaagcttttaaaaaattgttcgacaaagttatacgttaactctaat |
4074861 |
T |
|
| Q |
101 |
tcaaactgcactatttagataagatgatacaaacatttttcagcttaattagtcgtcacaagtttgagtcaatcatcccttaaaaatac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4074860 |
tcaaactgcactatttagataagatgatacaaacatttttcagcttaattagttgtctcaagtttgagtcaatcatcccttaaaaatac |
4074772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University