View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19106_low_26 (Length: 212)
Name: NF19106_low_26
Description: NF19106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19106_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 9463822 - 9464021
Alignment:
| Q |
1 |
tgatcgatctagtttatattatgagtaaggtgacggaggatttaggtttcttagagatgctaacctaattgggacgtccaagtctccctttcatactttt |
100 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| ||||||||||||||| | || ||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
9463822 |
tgatcgatctaatttatattatgaataaggtgaccgaggatttaggtttcatggaaatgctaacctagttgggacgtccaaatctccctttcatactttt |
9463921 |
T |
 |
| Q |
101 |
cattactcttagctcat------nnnnnnnctacaatatattctacttgtgcataaatatgttctcacccaaattgtggattatattcgtagataatatt |
194 |
Q |
| |
|
|| ||||||||| |||| || ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9463922 |
caatactcttagttcataaaaaataaaaaactgcaatatattctacttatgcataaatatgttctcacccaaattgtgcattatattcgtagataatatt |
9464021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University