View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19106_low_7 (Length: 447)
Name: NF19106_low_7
Description: NF19106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19106_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 6e-41; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 31157817 - 31157906
Alignment:
| Q |
17 |
agggtgaagtacaaaccagtagcaggagcaggtgaagtagtggcagttggtgctggttcttgtaccggtgatggaacgggggccgtagga |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31157817 |
agggtgaagtacataccagtagcaggagcaggtgaagtagtggcagttggtgctggttcttgtaccggtgatggaacgggggccgtagga |
31157906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 117 - 278
Target Start/End: Original strand, 31158314 - 31158482
Alignment:
| Q |
117 |
cacccacaatgaagtttttagctacggacccatgaagaagactagccacaacaagcaacgcaaacacgagagcatttatgttgcttgccatggttgtgta |
216 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||||| ||||||| | |||| | |||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
31158314 |
cacccacggtgaaggttttagctacggatccatgaagaaggttagccactgcgagcagcacaaaaacaagaccatttatgttgcttgccatggttgtgta |
31158413 |
T |
|
| Q |
217 |
gtgattgttctt-------ataagtggagttgcccttgttttctacgaatatgctttgcgtttgtttgg |
278 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31158414 |
gtgattgttcttacaagtaataagttgagttgcccttgttttctacgaatatgctttgcgtttgtttgg |
31158482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 325
Target Start/End: Original strand, 31158482 - 31158514
Alignment:
| Q |
293 |
gtttctaaaatggaagaacttatgaggataatg |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31158482 |
gtttctaaaatggaagaacttatgaggataatg |
31158514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 376 - 438
Target Start/End: Original strand, 31159281 - 31159344
Alignment:
| Q |
376 |
ggaagtagcatagaagaaaacatgcatacgagtcttcg-gtggttagagttgtgagtcaatatt |
438 |
Q |
| |
|
||||||||| ||||||||||| || | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31159281 |
ggaagtagcgtagaagaaaacttggacacgagtcttttagtggttagagttgtgagtcaatatt |
31159344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University