View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19107_low_5 (Length: 239)
Name: NF19107_low_5
Description: NF19107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19107_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 29708764 - 29708593
Alignment:
| Q |
18 |
gcaataatatgtcgccttgcgttttcctaattgaaaatattgcatcagttaagtaactttgaatcatgattcatgagattgattagccagagagccagac |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29708764 |
gcaataatatgtcgtcttgcgttttcctaattgaaaatattgcatcagtgaagtaactttgaatcatgattcatgggattgattagccagagagccagac |
29708665 |
T |
 |
| Q |
118 |
ctttttatcttcaatgttaacctatgtttgaaaatgattaattaattataattagacattgtgttagtattg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
29708664 |
ctttttatcttcaatgttaacctatgtttgaaaatgattaattaattaaaattagccattgtgttagtattg |
29708593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University