View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19108_low_6 (Length: 226)
Name: NF19108_low_6
Description: NF19108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19108_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 2935422 - 2935224
Alignment:
| Q |
19 |
cctttgggggtagagaacaaccctgctgaatatcttgcctcattcccactcatcatcaccctgtgaaatggcgaatgcagcctcccgtttgaccatgcct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2935422 |
cctttgggggtagagaacaaccctgctgaatatcttgcctcattcccactcatcatcaccctgtgaaatggcgaatgcaacctcccgtttgaccatgcct |
2935323 |
T |
|
| Q |
119 |
acaaaaatttacatgagaaatgaaaattttcaatataattcaacaaatgccagaataat---attgtttttaaaatgcacgtgaccacggtctgtgctgc |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2935322 |
ac-aaaatttacatgagaaatgaaaattttcaatataattcaacaagtgccagaataataaaattgtttttaaaatgcacgtgaccacggtctgggctgc |
2935224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 2920574 - 2920469
Alignment:
| Q |
19 |
cctttgggggtagagaacaaccctgctgaatatcttgcctcattcccactcatcatcaccctgtgaaatggcgaatgcagcctcccgtttgaccatgcct |
118 |
Q |
| |
|
||||| ||| ||||||||| ||| | |||||||| |||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2920574 |
cctttcgggatagagaacagcccggttgaatatcgtgcctcgttcccactcatcatcacccgatgaaacggcgaatgcagcctcccgtttgaccatgcct |
2920475 |
T |
|
| Q |
119 |
acaaaa |
124 |
Q |
| |
|
||||| |
|
|
| T |
2920474 |
gcaaaa |
2920469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University