View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19109_high_11 (Length: 228)
Name: NF19109_high_11
Description: NF19109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19109_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 23 - 131
Target Start/End: Original strand, 48662441 - 48662549
Alignment:
| Q |
23 |
gagtaaatgactgagctgtgagtaaatgaagtgtaatataaagtataaacatagtatgtactaaagtattaaatcccccacctaatttggtttctgcata |
122 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48662441 |
gagtaaatgactgagctgtgagtcaatgaagtgtaatataaaatataaacatagtatgtactaaagtattaaatcccccacctaatttggtttctgcata |
48662540 |
T |
|
| Q |
123 |
cgtacgttt |
131 |
Q |
| |
|
|||||||| |
|
|
| T |
48662541 |
tgtacgttt |
48662549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 48663285 - 48663389
Alignment:
| Q |
124 |
gtacgtttatgtttataagctatacaatcttatactataaagaattcctaaattaagcatcaatctatctatttgtctcttataaagcaattactctgtg |
223 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48663285 |
gtacctttatgtttataagctatacaatcttatactataaagaattcctaaattaagcatcaatctatctatttgtctcttataaagcaattactttgtg |
48663384 |
T |
|
| Q |
224 |
ctgct |
228 |
Q |
| |
|
|||| |
|
|
| T |
48663385 |
atgct |
48663389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University