View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_23 (Length: 399)
Name: NF1910_high_23
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 39044828 - 39045053
Alignment:
| Q |
19 |
cttcaccatggattgggcggttacgagattggttgatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39044828 |
cttcaccatggattgggcggttacgagattggtagatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagt |
39044927 |
T |
|
| Q |
119 |
gatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39044928 |
gatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggt |
39045027 |
T |
|
| Q |
219 |
gattgtggttgtgatggtgagtggcg |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39045028 |
gattgtggttgtgatggtgagtggcg |
39045053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 303 - 390
Target Start/End: Original strand, 39045112 - 39045199
Alignment:
| Q |
303 |
tggttattgcgagtttaatgggtttgttcatggttgtgattttattttatacagcaaatgtgtatgtttggtcgtaatggagtattat |
390 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39045112 |
tggttattgcgagtttaatgggtttattcatggttgtgattttattttatacagcaactgtgtatgtttggtcgtaatggagtattat |
39045199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 149 - 224
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
| Q |
149 |
gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt |
224 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || ||||| || ||||||| |||| |
|
|
| T |
40022292 |
gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt |
40022367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University