View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_31 (Length: 363)
Name: NF1910_high_31
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 48070438 - 48070081
Alignment:
| Q |
1 |
aaaatcacctttgggtttattataaggactactataacccattgggctatcagtttcaacagaagcccttgtaatagttggacttctattctcaaacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070438 |
aaaatcacctttgggtttattataaggactactataacccattgggctatcagtttcaacagaagcccttgtaatagttggacttctattctcaaacatg |
48070339 |
T |
 |
| Q |
101 |
atttttgcatccaaaggtccagatattggactcttggtgaatcttccatcaatagccctacttcttaatggacttctattagtataaatcatcattctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070338 |
atttttgcatccaaaggtccagatattggactcttggtgaatcttccatcaatagccctacttcttaatggacttctattagtataaatcatcattctct |
48070239 |
T |
 |
| Q |
201 |
cattcatcaatcttccatcaattggtcctgataacttcaatgccttattattgctgaccattttctgctcatgcattcttccatctaatggtcctgaata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070238 |
cattcatcaatcttccatcaattggtcctgataacttcaatgccttattattgctcaccattttctgctcatgcattcttccatctaatggtcctgaata |
48070139 |
T |
 |
| Q |
301 |
tggcattgttccgcttctatatataggtctctgatgcttctcttccttgaccaatgct |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070138 |
tggcattgttctgcttctatatataggtctctgatgcttctcttccttgaccaatgct |
48070081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University