View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_32 (Length: 359)
Name: NF1910_high_32
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 63 - 337
Target Start/End: Original strand, 50920385 - 50920659
Alignment:
| Q |
63 |
cactccttaatttggggagttgacattatgtattgcttctataaaaggaatattagcttctcaacggaagtatattgatctcttgtagactggaatgagt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50920385 |
cactccttaatttggggagttgacattatgtattgcttcaataaaaggaatattagcttctcaatggaagtatattgatctcttttagactggaatgagt |
50920484 |
T |
 |
| Q |
163 |
ggttgaaggccagacgatacacctgtgaacacaaatgaaaatcttggggaaaaaggaaatattctggttgattttcggagatactagaggttagctggaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50920485 |
ggttgaaggccagacgatacacctgtgaactcaaatgaaaatcttggggaaaaaggaaatattctggttgattttcggagatactagaggttagctggaa |
50920584 |
T |
 |
| Q |
263 |
aattaatatacttggcacatactcgtcccgatgttgcctttcccgcaagtgttgccggtcattttatgtaccccg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50920585 |
aattaatatacttggcacatactcgtcccgatgttgcctttcccgcaagtgttgccgatcattttatgtaccccg |
50920659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 20744146 - 20744068
Alignment:
| Q |
229 |
gttgattttcggagatactagaggttagctggaaaattaatatacttggcacatactcgtcccgatgttgcctttcccg |
307 |
Q |
| |
|
|||||| || |||||||||||| ||| | ||||||||| |||||||||| ||||| ||||| ||| ||||||| |||| |
|
|
| T |
20744146 |
gttgatattgggagatactagaagttggttggaaaattggtatacttggcccatacccgtcctgatattgccttacccg |
20744068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University