View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_46 (Length: 300)
Name: NF1910_high_46
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 16 - 176
Target Start/End: Original strand, 51353630 - 51353794
Alignment:
| Q |
16 |
ataagatggcgctgtatcatgttacttggtgaattagtgtagaatataatatttgaatgtgtccactatgaatatt----taaaaggcacgcgtcgtgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51353630 |
ataagatggcgctgtatcatgttacttggtgaattagtgtagaatataatatttgaatgtgtccactatgaatatttatttaaaaggcacgcgtcgtgaa |
51353729 |
T |
 |
| Q |
112 |
ttagtgtgtatgtgggtcacatatttatcttttctctcacaatagagagagtttttggagtgttg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51353730 |
ttagtgtgtatgtgggtcacatatttatcttttctctcacaatagagagagtttttggagtgttg |
51353794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 300
Target Start/End: Original strand, 51353887 - 51353918
Alignment:
| Q |
269 |
ttggcatattaggggtttttcactgagaagta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51353887 |
ttggcatattaggggtttttcactgagaagta |
51353918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University