View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_61 (Length: 253)
Name: NF1910_high_61
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 24 - 152
Target Start/End: Complemental strand, 2813751 - 2813623
Alignment:
| Q |
24 |
attatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcattggtatattatgttcctgttattacaaactgcaaaataata |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813751 |
attatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcatggatatattatgttcctgttattacaaactgcaaaataata |
2813652 |
T |
 |
| Q |
124 |
aaacgttttgcagatgtaagactactatg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2813651 |
aaacgttttgcagatgtaagactactatg |
2813623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 2813549 - 2813497
Alignment:
| Q |
191 |
tcggatgaataagtatctgtctccattggcattgctgcatatcttcccctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813549 |
tcggatgaataagtatctgtctccattggcattgctgcatatcttcccctatg |
2813497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University