View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_75 (Length: 236)
Name: NF1910_high_75
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 229
Target Start/End: Complemental strand, 40480317 - 40480093
Alignment:
| Q |
4 |
aacatactcttcttcttcctcgatttcaaactcaccaaatcgccggccaaaaattgctctacacacatgcaatcataaccaagaaaattgcaacccataa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40480317 |
aacatactcttcttcttcctcgatttcaaactcaccaaatcgccggccaaaaattgctctacacacatgcaatcataaccaagaaaattgcaacccataa |
40480218 |
T |
 |
| Q |
104 |
atttcttcttcatttgttcgattttgttggtcaaatatgaaaggggacaaatgaaaaccaatttacattctgattgannnnnnnnnnctcttattttaat |
203 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40480217 |
atatcttcttcatttgttcgattttgttggtcaaatatgaaaggggacaaatgaaaaccaatttacattctgattga-ttttttttcctcttattttaat |
40480119 |
T |
 |
| Q |
204 |
tcgaaattgtgaggtggcctttgtta |
229 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
40480118 |
tcgaaattgtgaggtggccttggtta |
40480093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University