View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_80 (Length: 229)
Name: NF1910_high_80
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 38227720 - 38227932
Alignment:
| Q |
1 |
ctcttttcgagcatcagtagttgtggaagactcaacaaaagagaaagacgggtatctggttgtttgaagagactgattattggtttttggtttgtgatgg |
100 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38227720 |
ctcttttccagcatcattagttgttgaagactcaacaaaagagaaagacgggtatctggttttttgaagagactgattattggtttttggtttttgatgg |
38227819 |
T |
 |
| Q |
101 |
aaagaatgatcatgagaaggagatgaagaagaatacatattcttcttcatgatgatgcgattgatggaagcaacaaaagaaataggttttgaattggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38227820 |
aaagaatgatcatgagaaggagatgaagaagaatacatattcttcttcatgatgatgcgattgatggaagcaacaaaagaaataggttttgaattggaaa |
38227919 |
T |
 |
| Q |
201 |
gcgtggaattaaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38227920 |
gcgtggaattaaa |
38227932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University