View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_86 (Length: 225)
Name: NF1910_high_86
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 13775641 - 13775449
Alignment:
| Q |
15 |
gaatatagaccacaaattgctttgaatcaggaactattattaccaaacaagaacatagatgtgcaccaaacnnnnnnngaaattcccccaatttattatt |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13775641 |
gaatatagacctcaaattgctttgaatcaggaactattattaccaaacaagaacatagatgtgcaccaaactttt---gaaattcccccaatttattatt |
13775545 |
T |
|
| Q |
115 |
ttcaatttcgaaccaaactcttgaagttccctcaatttagtacacttatcaaaccatctgtcatgtatgtaaaatagagaaattctatgaggttat |
210 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
13775544 |
ttcaatttcgaaccaaactctagaaattcccccaatttagtacacttatcaaaccatctgtcatgtatgtaaaatagataaattttatgaggttat |
13775449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University