View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1910_high_86 (Length: 225)

Name: NF1910_high_86
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1910_high_86
NF1910_high_86
[»] chr2 (1 HSPs)
chr2 (15-210)||(13775449-13775641)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 13775641 - 13775449
Alignment:
15 gaatatagaccacaaattgctttgaatcaggaactattattaccaaacaagaacatagatgtgcaccaaacnnnnnnngaaattcccccaatttattatt 114  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
13775641 gaatatagacctcaaattgctttgaatcaggaactattattaccaaacaagaacatagatgtgcaccaaactttt---gaaattcccccaatttattatt 13775545  T
115 ttcaatttcgaaccaaactcttgaagttccctcaatttagtacacttatcaaaccatctgtcatgtatgtaaaatagagaaattctatgaggttat 210  Q
    ||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||    
13775544 ttcaatttcgaaccaaactctagaaattcccccaatttagtacacttatcaaaccatctgtcatgtatgtaaaatagataaattttatgaggttat 13775449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University