View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_89 (Length: 223)
Name: NF1910_high_89
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 52 - 209
Target Start/End: Complemental strand, 42933426 - 42933268
Alignment:
| Q |
52 |
atgtgaagtaggaagaatgagaatggagggg-aagtgtatataaaggtagatggttacagacttacagcacacagatgcttctaactttctcagtgnnnn |
150 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933426 |
atgtgaagtaggaagaatgagaacggagggggaagtgtatataaaggtagatggttacagacttacagcacacagatgcttctaactttctcagtgtttt |
42933327 |
T |
|
| Q |
151 |
nnnnnnnnaataggaaaatgtgcttcttcctatgtttggatttactccttgcatgaggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933326 |
tgttttttaataggaaaatgtgcttcttcctatgtttggatttactccttgcatgaggt |
42933268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University