View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_high_91 (Length: 222)
Name: NF1910_high_91
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_high_91 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42800509 - 42800730
Alignment:
| Q |
1 |
gttgttaggggggtggatttttcttgcaatatagttgctacttaaaatgtcggtttaatggattcttgtttataatatacaaatttgttataaatgtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42800509 |
gttgttaggggggtggatttttcttgcaatatagttgctacttaaaatgtcggtttaatggattcttgtttataatatacaaatttgttataaatgtgat |
42800608 |
T |
 |
| Q |
101 |
tattgtctataatgttgtttattatagtggttgagtactactcccagttaaagaattttcatattataaacctatgactaatcaaatctctttaatcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800609 |
tattgtctataatgttgtttattatagtggttgagtactactcccagttaaaggattttcatattataaacctatgactaatcaaatctctttaatcaga |
42800708 |
T |
 |
| Q |
201 |
gaagaaacttcaaaaattcctt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42800709 |
gaagaaacttcaaaaattcctt |
42800730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University