View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_100 (Length: 221)
Name: NF1910_low_100
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_100 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 31966635 - 31966431
Alignment:
| Q |
13 |
atactaatgttaatatgatctttcttaatgatgtggatcctccctccttaacattgataagttagtagataatttatttagttttaagttattatcattt |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31966635 |
atactaatgttaatatgatatttcttaatgatgtggatcctctct----aacattgataagttagtagataattcatttagttttaagttattatcattt |
31966540 |
T |
|
| Q |
113 |
ttggattcttactctaggtacaacaaaatcagcatggcttatgaatgaatcatgcaactatttttacaacgtaatgtcattcaaccataggaatacatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31966539 |
atggattcttactctaggtacaacaaaatcaccatggcttatgaatgaatcatgcaactatttttacaacgtaatgtcattcaaccataggaatacatgt |
31966440 |
T |
|
| Q |
213 |
gaaacctac |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
31966439 |
gaaacctac |
31966431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University