View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_46 (Length: 311)
Name: NF1910_low_46
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 126 - 304
Target Start/End: Original strand, 33432568 - 33432732
Alignment:
| Q |
126 |
gtttgatacaaattcaagaatgtaaacggcagaaaaagcagttaataacggagcccacatctccctcccggatttcatttatttacgtataaaaatacaa |
225 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| || |||| | ||||| |||| ||||||||||||||| |
|
|
| T |
33432568 |
gtttgatacaaattgaagaatgtaaacggcagaaaaagcagttaataacggg-----cagttccc----gaatttcgttta----cgtataaaaatacaa |
33432654 |
T |
 |
| Q |
226 |
acgtggaccccaccttcttccacctttctcactcatttctctataagtacaacatcatagctaacctctttctgtgctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33432655 |
acgtggaccccaccttcttccacctttctcac-catttcgctataagtacaacatcatagctaacatctttctgtgctc |
33432732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University