View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_53 (Length: 297)
Name: NF1910_low_53
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 285
Target Start/End: Complemental strand, 2095073 - 2094997
Alignment:
| Q |
209 |
acctctgtttgcccatttggctatattttgatcttcaaaggtccaccacaatacttaaatcaatttttattaatatt |
285 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||| | ||| || |||||| |||||| |||| |
|
|
| T |
2095073 |
acctcggtgtgcccatttggctatatcttgatcttcaaaggtccaccaccacactaaagtcaattattattattatt |
2094997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 66
Target Start/End: Original strand, 36789450 - 36789479
Alignment:
| Q |
37 |
tcaatttaaatgtgacacgtgacaatacaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36789450 |
tcaatttaaatgtgacacgtgacaatacaa |
36789479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University