View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_57 (Length: 270)
Name: NF1910_low_57
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 34381371 - 34381468
Alignment:
| Q |
18 |
tgaaggaaggaagggttttgaaggagaaaaatgaggataagggg-ttatatactatttcgatgggttttgtgaccaaaatatcccaaacaaaactaata |
115 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
34381371 |
tgaaggaag-aagggtttagaaggagaaaaatgaggataagggggttatatactatttcgatgggttttgtgacgaaaatttcccaaacaaaattaata |
34381468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 219
Target Start/End: Original strand, 34381595 - 34381635
Alignment:
| Q |
179 |
aaaattcttgaattaaaattatatagttgtattatcattga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381595 |
aaaattcttgaattaaaattatatagttgtattatcattga |
34381635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University