View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_58 (Length: 269)
Name: NF1910_low_58
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 108 - 252
Target Start/End: Complemental strand, 34353777 - 34353642
Alignment:
| Q |
108 |
attcaatgtaaaccttttactcatactaataccaacatttttagtttcatatccggtttcaactttcagaattgagacctggannnnnnngcactcaaac |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34353777 |
attcaatggaaaccttttactcatactaataccaacatttttagtttcatatccggtttcaactttcagaattgagacctggatttttttg--------- |
34353687 |
T |
|
| Q |
208 |
cactcaaggcattaaattatatctagactttacatcttagttctt |
252 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34353686 |
cactcaaggcattaaattatatctagaatttacatcttagttctt |
34353642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 34354018 - 34353937
Alignment:
| Q |
18 |
agaacaaccatacaaatatgagagagacgccaccatcatatctctatctaaaaccttacaacatcaagttaat-ggcgattcac |
100 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34354018 |
agaacaaccatacaaat--gagagagacaccaccatcatatctctatctaaaaccttacaacatcaagttaatgggcgattcac |
34353937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University