View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_60 (Length: 265)
Name: NF1910_low_60
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 72 - 112
Target Start/End: Complemental strand, 16978184 - 16978144
Alignment:
| Q |
72 |
ggtgagtttgatgataaagataaaaactttgttgatttgga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16978184 |
ggtgagtttgatgataaagataaaaactttgttgatttgga |
16978144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 225 - 255
Target Start/End: Complemental strand, 16978031 - 16978001
Alignment:
| Q |
225 |
aatagttcttctggctctcactatgatgatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16978031 |
aatagttcttctggctctcactatgatgatg |
16978001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University