View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1910_low_66 (Length: 253)

Name: NF1910_low_66
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1910_low_66
NF1910_low_66
[»] chr2 (2 HSPs)
chr2 (24-152)||(2813623-2813751)
chr2 (191-243)||(2813497-2813549)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 24 - 152
Target Start/End: Complemental strand, 2813751 - 2813623
Alignment:
24 attatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcattggtatattatgttcctgttattacaaactgcaaaataata 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||    
2813751 attatatacatagcacaaatgaccactataatatatgatttgaaatttaaaataatcatggatatattatgttcctgttattacaaactgcaaaataata 2813652  T
124 aaacgttttgcagatgtaagactactatg 152  Q
    |||||||||||||||||||||||||||||    
2813651 aaacgttttgcagatgtaagactactatg 2813623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 2813549 - 2813497
Alignment:
191 tcggatgaataagtatctgtctccattggcattgctgcatatcttcccctatg 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2813549 tcggatgaataagtatctgtctccattggcattgctgcatatcttcccctatg 2813497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University