View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_67 (Length: 252)
Name: NF1910_low_67
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 100 - 226
Target Start/End: Original strand, 6897804 - 6897932
Alignment:
| Q |
100 |
tgggaatttggtactatacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttcttttctag |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6897804 |
tgggaatttggtactgtacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttcttttctag |
6897903 |
T |
 |
| Q |
200 |
tactc--tgtgtactgtattgtctgctat |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
6897904 |
tactctttgtgtactgtattgtctgctat |
6897932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 6897702 - 6897741
Alignment:
| Q |
1 |
agtttatctataaatggctaattcctaagaatattcacag |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6897702 |
agtttatctataaatggctaattcctaagaatattcacag |
6897741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University