View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1910_low_67 (Length: 252)

Name: NF1910_low_67
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1910_low_67
NF1910_low_67
[»] chr8 (2 HSPs)
chr8 (100-226)||(6897804-6897932)
chr8 (1-40)||(6897702-6897741)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 100 - 226
Target Start/End: Original strand, 6897804 - 6897932
Alignment:
100 tgggaatttggtactatacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttcttttctag 199  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6897804 tgggaatttggtactgtacaaaccagaatctatgcatgtcaagtttcaaattgaaacagaaagtgtggtgtcccacaaacaacactggtttcttttctag 6897903  T
200 tactc--tgtgtactgtattgtctgctat 226  Q
    |||||  ||||||||||||||||||||||    
6897904 tactctttgtgtactgtattgtctgctat 6897932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 6897702 - 6897741
Alignment:
1 agtttatctataaatggctaattcctaagaatattcacag 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
6897702 agtttatctataaatggctaattcctaagaatattcacag 6897741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University