View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_68 (Length: 252)
Name: NF1910_low_68
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_68 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 29110884 - 29110651
Alignment:
| Q |
1 |
ctggccatcacactcttctacacacactatctaatttgaggagtatatatgaacatgaccatacatacatgtactattattaattcgataagattatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110884 |
ctggccatcacactcttctacacacactatctaatttgaggagtatatatggatatgaccatacatacatgtactattattaattcgataagattatagt |
29110785 |
T |
|
| Q |
101 |
tatgaatttatgatggttttggttggcgttgttaattatgcagccttgaagtatggtattttatggcattaatactatttgctggatatctggagaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110784 |
tatgaatttatgatggttttggttggcgttgttaattatgcagccttgaagtatggtattttatggcattaatactatttgctggatatctggagaatgc |
29110685 |
T |
|
| Q |
201 |
agaagtttcagttgatgcattgtctatatggtga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29110684 |
agaagtttcagttgatgcattgtctatatggtga |
29110651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 232
Target Start/End: Complemental strand, 14266694 - 14266615
Alignment:
| Q |
153 |
atggtattttatggcattaatactatttgctggatatctggagaatgcagaagtttcagttgatgcattgtctatatggt |
232 |
Q |
| |
|
|||||| ||||||||||| || || |||||||||||||| ||||||||||| | ||||| ||||| || ||||| |||| |
|
|
| T |
14266694 |
atggtactttatggcattgattctgtttgctggatatctcaagaatgcagaaatctcagtagatgccttctctatctggt |
14266615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University