View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_75 (Length: 241)
Name: NF1910_low_75
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 37468027 - 37468250
Alignment:
| Q |
1 |
caaaaactacgcgccttattgcacgtcaaactccctccacagcattcccgtcatcacaaccgtcgatcacattactaacccactcaatcaacggctgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468027 |
caaaaactacgcgccttattgcacgtcaaactccctccacagctttcccgtcatcacaaccgtcgatcacattactaacccactcaatcaacggctgaaa |
37468126 |
T |
|
| Q |
101 |
acgtttcttaccaatcatcacgagaaatgcatgaaaaggaaccccatatataaacaccgttgcttcttcttcagtaactgtaattccagatttcttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37468127 |
acgtttcttaccaatcatcacgagaaatgcatgaaaaggaaccccatatataaacaccgttgcttcttcttcggtaactgtaattccagatttcttggaa |
37468226 |
T |
|
| Q |
201 |
acttatcaaaacgcgattccttcg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37468227 |
acttatcaaaacgcgattccttcg |
37468250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University