View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_78 (Length: 238)
Name: NF1910_low_78
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 16978489 - 16978599
Alignment:
| Q |
1 |
tccaaacccatatcatcttcatctctctttcttagccgcttcgatttcactggaagacagcggaacaatggaacattcttgcttcgagttctgcttgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16978489 |
tccaaacccatatcatcttcatcactctttcttagccgcttcgatttcagtggaagacaacggaacaatggaacattcttgcttcgagttctgcttgaaa |
16978588 |
T |
|
| Q |
101 |
cactagccatt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
16978589 |
cactagccatt |
16978599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 111
Target Start/End: Original strand, 16969366 - 16969461
Alignment:
| Q |
16 |
tcttcatctctctttcttagccgcttcgatttcactggaagacagcggaacaatggaacattcttgcttcgagttctgcttgaaacactagccatt |
111 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |||||||| | |||||||||||||| ||||| ||||||||||| |||| || ||||||| |
|
|
| T |
16969366 |
tcttcatcactctttcttcgccgcttcgatttcggaggaagacaaccaaacaatggaacatttttgctacgagttctgctagaaataccagccatt |
16969461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 195
Target Start/End: Original strand, 16978651 - 16978683
Alignment:
| Q |
163 |
acgttgttctttctctgttatatgttagtactt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16978651 |
acgttgttctttctctgttatatgttagtactt |
16978683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Complemental strand, 35262210 - 35262164
Alignment:
| Q |
64 |
aacaatggaacattcttgcttcgagttctgcttgaaacactagccat |
110 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
35262210 |
aacaacggaacattcttgctacgagttctgctagaaacaccagccat |
35262164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University