View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_88 (Length: 228)
Name: NF1910_low_88
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 212
Target Start/End: Complemental strand, 31264137 - 31263935
Alignment:
| Q |
10 |
gtagataattctaacgacgttggtaggcttctactcggtaggtagagccaacataactttgtatgtaaggtaaatgatgcagttaatcctccccctaaac |
109 |
Q |
| |
|
||||||| ||| |||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31264137 |
gtagatatatctgacgatgttggtaggcttcgactcggtaggtagagtcaacataactttgtatgtaaggcaaatgatgcagttaatcctccccctaaac |
31264038 |
T |
 |
| Q |
110 |
gggactgacgtaggcatcagactcnnnnnnncgatgagtcaaactcctcataagtggttgagcctacacctgttgcgcataaggagtatctagacgatgt |
209 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31264037 |
gggactgacgtaggcatctgactcaaaacgacgatgagtcaaactcctcataagtggttgagcctacacctgttgcgcataaggagtatctagacgatgt |
31263938 |
T |
 |
| Q |
210 |
ttt |
212 |
Q |
| |
|
||| |
|
|
| T |
31263937 |
ttt |
31263935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University