View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_89 (Length: 227)
Name: NF1910_low_89
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_89 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 43246813 - 43246606
Alignment:
| Q |
20 |
attatcccatgcatgaaattgcattctatatgaaaaatttatgatattatccatagacctccctctcttctataaatacctaccatttcttcttatcctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43246813 |
attatcccatgcatgaaattgcattctatatgaaaaatttatgatattatccatcgacctccctctcttctataaatacctaccatttcttcttatcctt |
43246714 |
T |
|
| Q |
120 |
ctcattcaaaacatatccaacaagtactacttttactcatatccaactttgttttacctctcatacatagctttaaacacaaaaacaatgaagttcatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43246713 |
ctcattcaaaacatatccaacaagtactacttttactcatatccaactttgttttacctctcatacatagctttaaacacaaaaacaatgaagttcatca |
43246614 |
T |
|
| Q |
220 |
agaccctt |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
43246613 |
agaccctt |
43246606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 117 - 227
Target Start/End: Complemental strand, 8541395 - 8541294
Alignment:
| Q |
117 |
cttctcattcaaaacatatccaacaagtactacttttactcatatccaactttgttttacctctcatacatagctttaaacacaaaaacaatgaagttca |
216 |
Q |
| |
|
|||||||||||||||||||| | |||||| || |||||||| ||||||||| |||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
8541395 |
cttctcattcaaaacatatctaccaagtatta---ttactcatttccaactttcttttacctct----cctagctttaaacacaaaa--aatgaagttca |
8541305 |
T |
|
| Q |
217 |
tcaagaccctt |
227 |
Q |
| |
|
|||| |||||| |
|
|
| T |
8541304 |
tcaataccctt |
8541294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University