View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1910_low_90 (Length: 226)
Name: NF1910_low_90
Description: NF1910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1910_low_90 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 11190543 - 11190332
Alignment:
| Q |
1 |
tagaagagagcaaggaatcattcctgaagtagtgacaaacagaatgataggtagaatggcattgtctgttgggattccattaagtgttggacttttgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11190543 |
tagaagagagcaaggaatcattcctgaagtagtgacaaacagaatgatagggagaatggcattgtctgttgggattccattaagtgttggacttttgttc |
11190444 |
T |
|
| Q |
101 |
tttccannnnnnnactatcttaaagttggtttgaaaattgatgtgccaaattgggttccatttcttgtgtctttcttcttttttgggtctgctcttttag |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11190443 |
tttccatttttttactatcttaaagttggtttgaaaattgatgtgccaaattgggttccatttcttgtgtctttcttcttttttgggtctgcacttttag |
11190344 |
T |
|
| Q |
201 |
gagtgagttatg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11190343 |
gagtgagttatg |
11190332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University