View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19110_low_8 (Length: 247)
Name: NF19110_low_8
Description: NF19110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19110_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 23357981 - 23358211
Alignment:
| Q |
17 |
aggaatttggttcaaaattatccctataaaaacagttgtttgggtagccaatcgcaacaatccaatcagtgacaaatccggcatattgagcgtaaacaaa |
116 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23357981 |
aggaatttggttcaaaactatccctttaaaaacagttgtttgggtagcaaatcgcgacaatccaatcagtgacaaatccggcatattgagcgtaaacaaa |
23358080 |
T |
 |
| Q |
117 |
gaaggaaaccttgttcttctcagcaaaaatggcacaactcattggtcaacaaatgtaacaaccaaaccttcaacctcaagcttcgcagcaacgctcttag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
23358081 |
gaaggaaaccttgttcttctcagcaaaaatggcacaactcattggtcaacaaatgtaacaaccaaaccttcaacctcaagcttcatagcaaagctcttag |
23358180 |
T |
 |
| Q |
217 |
gtaccggaaacttggttgtaaataatgagaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23358181 |
gtaccggaaacttggttgtaaataatgagaa |
23358211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University