View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19111_high_19 (Length: 269)
Name: NF19111_high_19
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19111_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 266
Target Start/End: Original strand, 28195085 - 28195330
Alignment:
| Q |
21 |
gacccaagaacacgtccaacatatcttgagcaggatggcctatttgagatgtgcttgtagggattacgtctccagttgttggagaagaattatataaagc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28195085 |
gacccaagaacacgtccaacatatcttgagcaggatggcctatttgagatgtgcttgtagggattacgtctccagttgttggagaagaattatataaagc |
28195184 |
T |
 |
| Q |
121 |
ttcccttaccgaactagatggttttttgttctcacgaagggaatcaagcgttgttcctgcttcagctgtggccggaaattgccattttggctcacactgt |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28195185 |
ttcccttaccgaactagacggttttttgttctcacgaagggaatcaagcgttgttcctgcttcagctgtggccggaaactgccattttggctcacactgt |
28195284 |
T |
 |
| Q |
221 |
ctacttgatgtttcttgcagttctttgtcctcatattcttcgacat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
28195285 |
ctacttgatgtttcttgcagttctttgtcctcacaatctttgacat |
28195330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University