View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19111_high_21 (Length: 253)
Name: NF19111_high_21
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19111_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 36470610 - 36470444
Alignment:
| Q |
8 |
gagagagatgaacaacatttgaagtgttctacttgtgaatcaatagcatcctatccaaattctatttgcaaatcaatcatttacatcaaataatctcaca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36470610 |
gagaaagatgaacaacatttgaagtgttctacttgtgaatcaatagcatcctatccaaattctatttgcaaatcaatcatttacatcaaataatctcaca |
36470511 |
T |
 |
| Q |
108 |
tatgattttggatttagagtgggaaatagtttactttctcaatatgaagcctaaccaacacatgcgc |
174 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36470510 |
tatggttttggatttagagtgggaaatagtttactttctcaatatgaagcctaaccaacacatgcgc |
36470444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University