View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19111_high_24 (Length: 238)
Name: NF19111_high_24
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19111_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1324665 - 1324440
Alignment:
| Q |
1 |
ctgttacaaattaagcatatatagtcaaacaaagaaattacctttttt-----gagaataatttgtattgaaaaaatctatgtaatactgacacttcaga |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1324665 |
ctgttacaaattaagcatatatagtcaaacaaagaaattaccttttttaatttgagtataatttgtattgaaaaaatctatgtaatactgacacttcaga |
1324566 |
T |
|
| Q |
96 |
ttgaatatatgtcggataccaatatgaaatagaatcattttacatttgatcacttttactttctcaaagtattaccacggtgtacatgtatcagtatcgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1324565 |
ttgaatatatgtcggataccaatatgaaatagaatcattttacatttgatcacttttactttcttaaagtattaccacggtgtacatgtatcggtatcgt |
1324466 |
T |
|
| Q |
196 |
gtccgtgtttgagtcgatagagacat |
221 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
1324465 |
gtccgtgtttgagtccatagagacat |
1324440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University