View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19111_low_24 (Length: 252)
Name: NF19111_low_24
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19111_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 73 - 242
Target Start/End: Complemental strand, 44001682 - 44001516
Alignment:
| Q |
73 |
ctagaagaacaactacaagaactagaacttttaacagtatcatcatcatcaagatggacaaagtgatgaggttggcatctgaaaaaggtgtggtgatttt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001682 |
ctagaagaacaactacaagaactagaacttttaacagtatcatcatca---agatggacaaagtgatgaggttggcatctgaaaaaggtgtggtgatttt |
44001586 |
T |
|
| Q |
173 |
cacaaagagttcatgttgtctatgctatgcagttaacattctgtttcaagaacttgggattaggcctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001585 |
cacaaagagttcatgttgtctatgctatgcagttaacattctgtttcaagaacttgggattaggcctatg |
44001516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 126 - 229
Target Start/End: Original strand, 39865935 - 39866038
Alignment:
| Q |
126 |
atggacaaagtgatgaggttggcatctgaaaaaggtgtggtgattttcacaaagagttcatgttgtctatgctatgcagttaacattctgtttcaagaac |
225 |
Q |
| |
|
||||| || |||||||||||||| | ||||| ||||||||| | ||||| ||||| || |||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
39865935 |
atggagaaggtgatgaggttggctacagaaaagggtgtggtggtattcaccaagagctcttgttgtctatgctatgcagtgaacattttgtttcaagaaa |
39866034 |
T |
|
| Q |
226 |
ttgg |
229 |
Q |
| |
|
|||| |
|
|
| T |
39866035 |
ttgg |
39866038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 229
Target Start/End: Original strand, 39861478 - 39861584
Alignment:
| Q |
123 |
aagatggacaaagtgatgaggttggcatctgaaaaaggtgtggtgattttcacaaagagttcatgttgtctatgctatgcagttaacattctgtttcaag |
222 |
Q |
| |
|
|||||||| || |||||||||||||| | ||||| ||||| ||||||||||| ||||| || |||||| | ||||||||||| |||||| ||||||||| |
|
|
| T |
39861478 |
aagatggagaaggtgatgaggttggctacagaaaagggtgttgtgattttcaccaagagctcttgttgtttgtgctatgcagtgaacattttgtttcaag |
39861577 |
T |
|
| Q |
223 |
aacttgg |
229 |
Q |
| |
|
|| |||| |
|
|
| T |
39861578 |
aaattgg |
39861584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University