View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19111_low_28 (Length: 237)
Name: NF19111_low_28
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19111_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 23569996 - 23569776
Alignment:
| Q |
3 |
tattgattggtcacatttatccttttggcttaatcaattgatcacttgaatttattatagatcttacatgacaattaaatgtccctaaagtaaattgaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23569996 |
tattgattggtcacatttatccttttggcttaatcaattgatcacttgaatttattatagatcttacatggcaattaaatgtccctaaagtaaattgaaa |
23569897 |
T |
|
| Q |
103 |
aattccattgattttttgggaccgtacatta-nnnnnnnatgtcctatccatcctcatctctaaacaacattaatgtgtagtgtttgtccttttagttca |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23569896 |
aattccattgatattttgggaccgtacattattttttttatgtcctatccatcctcatctctaaacaacattgatgtgtagtgtttgtccttttagttca |
23569797 |
T |
|
| Q |
202 |
gacaatgaatcacttgattat |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23569796 |
gacaatgaatcacttgattat |
23569776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 103
Target Start/End: Original strand, 24179606 - 24179646
Alignment:
| Q |
63 |
atcttacatgacaattaaatgtccctaaagtaaattgaaaa |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24179606 |
atcttacatgacaattaaatgtctctaaagtactttgaaaa |
24179646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 103
Target Start/End: Original strand, 24183929 - 24183969
Alignment:
| Q |
63 |
atcttacatgacaattaaatgtccctaaagtaaattgaaaa |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24183929 |
atcttacatgacaattaaatgtctctaaagtactttgaaaa |
24183969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University