View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19111_low_32 (Length: 205)

Name: NF19111_low_32
Description: NF19111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19111_low_32
NF19111_low_32
[»] chr5 (9 HSPs)
chr5 (23-187)||(32549390-32549554)
chr5 (100-187)||(32655666-32655753)
chr5 (101-187)||(32752145-32752231)
chr5 (101-187)||(32755688-32755774)
chr5 (108-187)||(32748101-32748180)
chr5 (107-178)||(28475205-28475276)
chr5 (147-190)||(32553013-32553056)
chr5 (101-180)||(32749626-32749704)
chr5 (100-180)||(32763338-32763418)
[»] chr7 (2 HSPs)
chr7 (102-168)||(37577563-37577629)
chr7 (149-182)||(32895069-32895102)
[»] chr1 (1 HSPs)
chr1 (115-179)||(17583835-17583899)


Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 187
Target Start/End: Original strand, 32549390 - 32549554
Alignment:
23 attatcttggatgttgtagttggcaagggtgtggtggttggaacatagcgcctcattgtcaaagaacaagtcatatccgtgcactgggatcccttccttg 122  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32549390 attatcttggatgttgtagttggcaagggtgtggcggttggaacatagcgcctcattgtcaaagaacaagtcatatccgtgcactgggatcccttccttg 32549489  T
123 tcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggggaacgtctt 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
32549490 tcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagagggaacctctt 32549554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 100 - 187
Target Start/End: Original strand, 32655666 - 32655753
Alignment:
100 cgtgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggggaacgtctt 187  Q
    ||||||| ||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||| || |||||| ||||    
32655666 cgtgcaccgggatcccttccttgtcctgaatcttcttcttcacatcgagtattgtgtctgaactcttaaccattagagggaacctctt 32655753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 101 - 187
Target Start/End: Complemental strand, 32752231 - 32752145
Alignment:
101 gtgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggggaacgtctt 187  Q
    |||||||||||||||||||||||| ||||| ||||||||||| || ||||||||||||||||||||||| || ||||||||| ||||    
32752231 gtgcactgggatcccttccttgtcatgaattttcttcttcacatcgagtatcgtgtctgaactcttaacaatgagggggaacatctt 32752145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 101 - 187
Target Start/End: Complemental strand, 32755774 - 32755688
Alignment:
101 gtgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggggaacgtctt 187  Q
    |||||||||||||||||||||||| ||||| ||||| ||||| || |||||||||||||||||||||||||| ||||||||| ||||    
32755774 gtgcactgggatcccttccttgtcatgaattttctttttcacatccagtatcgtgtctgaactcttaaccatgagggggaacatctt 32755688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 32748180 - 32748101
Alignment:
108 gggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggggaacgtctt 187  Q
    |||||||||||||||||||||| ||| |||||||| |  |||||||||||||||||||||||||||||||||||| ||||    
32748180 gggatcccttccttgtcctgaacctttttcttcacattgagtatcgtgtctgaactcttaaccatcagggggaacctctt 32748101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 28475276 - 28475205
Alignment:
107 tgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcagggg 178  Q
    ||||||||||||||||||  |||||||||||||||| || | ||||||||||||||||| |||| |||||||    
28475276 tgggatcccttccttgtcaagaatcttcttcttcacatcgactatcgtgtctgaactctcaaccctcagggg 28475205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 147 - 190
Target Start/End: Original strand, 32553013 - 32553056
Alignment:
147 agtatcgtgtctgaactcttaaccatcagggggaacgtcttcat 190  Q
    ||||||||||| ||||||||||||||||||||||| | ||||||    
32553013 agtatcgtgtccgaactcttaaccatcagggggaatgacttcat 32553056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 101 - 180
Target Start/End: Complemental strand, 32749704 - 32749626
Alignment:
101 gtgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcaggggga 180  Q
    ||||||||||||| ||||| | || | | ||||||||||||| | | ||||||||||||||||  |||||||||||||||    
32749704 gtgcactgggatcgcttccatttcataattcttcttcttcacatta-gtatcgtgtctgaacttgtaaccatcaggggga 32749626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 180
Target Start/End: Complemental strand, 32763418 - 32763338
Alignment:
100 cgtgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcaggggga 180  Q
    |||||| ||||||||||||||||||  ||||||| |||||||| |    ||| ||||||||||||| |||| ||| |||||    
32763418 cgtgcattgggatcccttccttgtcaagaatctttttcttcacattttctattgtgtctgaactctcaaccctcaagggga 32763338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Complemental strand, 37577629 - 37577563
Alignment:
102 tgcactgggatcccttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaa 168  Q
    |||| |||||||||||| |||||  ||||||||| |||||| ||   ||||||||||||||||||||    
37577629 tgcattgggatcccttcattgtcaagaatcttctccttcacatcggctatcgtgtctgaactcttaa 37577563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 182
Target Start/End: Complemental strand, 32895102 - 32895069
Alignment:
149 tatcgtgtctgaactcttaaccatcagggggaac 182  Q
    |||| |||||||||||||||||||||||||||||    
32895102 tatcctgtctgaactcttaaccatcagggggaac 32895069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 179
Target Start/End: Complemental strand, 17583899 - 17583835
Alignment:
115 cttccttgtcctgaatcttcttcttcacgtcaagtatcgtgtctgaactcttaaccatcaggggg 179  Q
    ||||||||||  |||||||||||||||| |  | |||||||||||||||||  ||| ||||||||    
17583899 cttccttgtcaagaatcttcttcttcacattcattatcgtgtctgaactctccaccctcaggggg 17583835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University