View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19113_high_39 (Length: 249)
Name: NF19113_high_39
Description: NF19113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19113_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 3391703 - 3391649
Alignment:
| Q |
1 |
tagaagaaaaacttttcaaaagacaaatttgtgaaaatagctctctattgccttt |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3391703 |
tagaagaaaaacttttcaacagacaaatttgtgaaaatagctctctattgccttt |
3391649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 3298810 - 3298773
Alignment:
| Q |
1 |
tagaagaaaaacttttcaaaagacaaatttgtgaaaat |
38 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3298810 |
tagaagaaaaacttttcaacagacaaatttgtgaaaat |
3298773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 162
Target Start/End: Complemental strand, 3391567 - 3391534
Alignment:
| Q |
129 |
gatcatgtttttgttacggattagaataaaagtg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3391567 |
gatcatgtttttgttacggattagaataaaagtg |
3391534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University