View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19113_high_45 (Length: 230)
Name: NF19113_high_45
Description: NF19113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19113_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 1069318 - 1069240
Alignment:
| Q |
134 |
ccgataaacccacgggtgactcggttttgagctataatcaaaacgctttatagcttgtaatcttcttagtaaaagatat |
212 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1069318 |
ccgataaacccatgggtgactcagttttgagctataatcaaaacgctttatagcttgtaatcttcttagtaaaggatat |
1069240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 1069354 - 1069318
Alignment:
| Q |
1 |
cacttcattctaatgatacggtcgggtatgggttcac |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1069354 |
cacttcattctaatgatacggtcgggtatgggttcac |
1069318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 1115693 - 1115740
Alignment:
| Q |
158 |
ttttgagctataatcaaaacgctttatagcttgtaatcttcttagtaa |
205 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
1115693 |
ttttgagttataatcaagacgctttatacgttgtaatcttcttagtaa |
1115740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 1115166 - 1115112
Alignment:
| Q |
158 |
ttttgagctataatcaaaacgctttatagcttgtaatcttcttagtaaaagatat |
212 |
Q |
| |
|
||||||| ||| ||| ||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
1115166 |
ttttgagttatgatccaaatgctttataccttgtaatcttcttagtaaaggatat |
1115112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University