View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19113_low_29 (Length: 286)
Name: NF19113_low_29
Description: NF19113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19113_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 27 - 270
Target Start/End: Original strand, 36579095 - 36579338
Alignment:
| Q |
27 |
gtggagaccaatcattgattgttcaaaatttgttaatttcagctttttatactttaaataactagactagatgtattattaattagatgtgtagtgtatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36579095 |
gtggagaccaatcattgattgttcaaaatttgttaatttcagctttttatactttaaataactagactagatatattattaattagatgtgtagtgtatg |
36579194 |
T |
 |
| Q |
127 |
catgacatcaaaatctattcccacggttatccgtctaaatccattttaatttgatggattttatccattttgaccgaatttggatatgagtttgagtttt |
226 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||| ||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
36579195 |
catgacatcaaaatctatttccgtggttatccgtctaaacccattttaatttgatggattttatctattttgaacgagtttagatatgagtttgagtttt |
36579294 |
T |
 |
| Q |
227 |
ttctgattaaaacacgggtacggataggtaataaggatatagat |
270 |
Q |
| |
|
| ||||||||||||||||||||||| | ||| |||||||||||| |
|
|
| T |
36579295 |
tcctgattaaaacacgggtacggatggataacaaggatatagat |
36579338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University