View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19113_low_42 (Length: 237)

Name: NF19113_low_42
Description: NF19113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19113_low_42
NF19113_low_42
[»] chr6 (1 HSPs)
chr6 (53-222)||(34182823-34182996)


Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 53 - 222
Target Start/End: Complemental strand, 34182996 - 34182823
Alignment:
53 ccgacaaaatctttgaattacttttataaataaacaactgaccatatttttcttatgaaattttgtatgatcatcatctatatgaaaagaaaatatttat 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34182996 ccgacaaaatctttgaattacttttataaataaacaactgaccatatttttcttatgaaattttgtatgatcatcatctatatgaaaagaaaatatttat 34182897  T
153 gcttagtgcatatcttggaaagattaattcaggaataaaaaattaa----tacaacattttaaatagaaaaaga 222  Q
    | ||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||    
34182896 gattagtgcatatcttggaaagattaattcaggaataaaaaattaatacgtacaacattttaaatagaaaaaga 34182823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University