View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19113_low_47 (Length: 205)
Name: NF19113_low_47
Description: NF19113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19113_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 49083000 - 49082847
Alignment:
| Q |
1 |
tacatgaggctcactatttctttcactgcattcaatatttttgtgtgtggaagccacggaaccactagaatgattgcttgcagcattgttttctgcagca |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083000 |
tacatgaggctcactatttttttcactgcattcaatatttttgtgtgtggaagccacagaaccactagaatgattgcttgcagcattgttttctgcagca |
49082901 |
T |
|
| Q |
101 |
acatcaagtttattctgtggaaatgttatgttttgaggaggcatgataatctgt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
49082900 |
acatcaagtttattctgtggaaatgttatattttgaggaggcatggtaatctgt |
49082847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University