View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19116_high_9 (Length: 254)
Name: NF19116_high_9
Description: NF19116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19116_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 72 - 243
Target Start/End: Original strand, 2906479 - 2906650
Alignment:
| Q |
72 |
agaaaattgatcaatttaccaaatgagatggaaacagttataggttgcaaagatgccaacattgcggttaaacacatgaactcgaactcgtggatggata |
171 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906479 |
agaagattgattaatttaccaaatgagatggaaacagttataggttgcaaagatgccaacattgcggttaaacacatgaactcgaactcgtggatggata |
2906578 |
T |
|
| Q |
172 |
tgcttgctacatatatttgctacaaatatggattgtttccctccttctagtactgttacttatgagccctat |
243 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906579 |
tgcttgctacaaatatttgctacaaatatggattgtttccctccttctagtactgttacttatgagccctat |
2906650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 69
Target Start/End: Original strand, 2906358 - 2906412
Alignment:
| Q |
15 |
atcacctactaggtgtgacatggatgtttccccttccagtttctgcttttttcta |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906358 |
atcacctactaggtgtgacatggatgtttccccttccagtttctgcttttttcta |
2906412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 61
Target Start/End: Original strand, 2902117 - 2902164
Alignment:
| Q |
14 |
catcacctactaggtgtgacatggatgtttccccttccagtttctgct |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2902117 |
catcacctactaggtgtgacatggatgtttccacttccagtttctgct |
2902164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 243
Target Start/End: Original strand, 2902480 - 2902535
Alignment:
| Q |
188 |
ttgctacaaatatggattgtttccctccttctagtactgttacttatgagccctat |
243 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||||||||| ||| ||||| |
|
|
| T |
2902480 |
ttgcaacaaatatggattgtttcccttcttccagtactgttacttacgaggcctat |
2902535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University