View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19117_low_17 (Length: 249)
Name: NF19117_low_17
Description: NF19117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19117_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 10843575 - 10843342
Alignment:
| Q |
1 |
aaaaattgtgagaagatggagctgtaaagatttcagattatgtaagccaatcgcaatcacctaaacttgctgagcaattctctcaaagaggtgaatattt |
100 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10843575 |
aaaaatggtgagaagatggagttgtaaagatttcagatcatgtaagcaaattgcaatcacctaaacttgctgagcaattctctcgaagaggtgaatattt |
10843476 |
T |
|
| Q |
101 |
tatttgtttcaaatcaaccttcctcattgacttttatttaaaaataggcttcttaatggagttgattgagtgacacagttagtttaaccttttactttct |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10843475 |
tatttgtttcaaatcaaccttcctcgttgacttttatttaaaaataggcttcttaatggagttgattgagtgacacagttagtttaaccttttactttct |
10843376 |
T |
|
| Q |
201 |
gctgacaacgatttctttgaaaaaataatgataa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10843375 |
gctgacaacgatttctttgaaaaaataatgataa |
10843342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University