View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19117_low_18 (Length: 228)
Name: NF19117_low_18
Description: NF19117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19117_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 42021401 - 42021596
Alignment:
| Q |
14 |
caaaggcaaagttttctgaaacaggaatttcacacgatatattgataaagtgtggagtagaagaagaaggatcaacatcaaagagtcacatgttatgttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021401 |
caaaggcaaagttttctgaaacaggaatttcacacgatatattgataaagtgtggagtagaagaagaaggatcaacatcaaagagtcacatgttatgttt |
42021500 |
T |
 |
| Q |
114 |
gtttatggataagaagattgtgtttaaggtgaagagattgaagtggaattttcgtggcaatcaaacaatttttgtggatggtttggtagtggatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021501 |
gtttatggataagaagattgtgtttaaggtgaagagattgaagtggaattttcgtggcaatcaaacaatttttgtggatggtttggtagtggatat |
42021596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 207
Target Start/End: Original strand, 36056063 - 36056149
Alignment:
| Q |
121 |
gataagaagattgtgtttaaggtgaagagattgaagtggaattttcgtggcaatcaaacaatttttgtggatggtttggtagtggat |
207 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||||||| | || ||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
36056063 |
gataagaagattgtaatttgtgtgaagaggttgaagtggaattttaggggtaatcaaacaatttttgttgatgggttgttggtggat |
36056149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 197
Target Start/End: Complemental strand, 20085525 - 20085449
Alignment:
| Q |
121 |
gataagaagattgtgtttaaggtgaagagattgaagtggaattttcgtggcaatcaaacaatttttgtggatggttt |
197 |
Q |
| |
|
|||||||||| |||| || |||||||||||| | ||||||||| | || |||||||| |||||||| |||||||| |
|
|
| T |
20085525 |
gataagaagaatgtgattcgtgtgaagagattgcaatggaattttagagggaatcaaaccatttttgttgatggttt |
20085449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University