View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19117_low_9 (Length: 403)
Name: NF19117_low_9
Description: NF19117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19117_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 4211576 - 4211813
Alignment:
| Q |
19 |
tgtaaaacagaaggagatctaaagagttgttggtgatggggttgttgaaagttaggatcttgttgttggagatgtttttgggtggcattggcaagagtgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211576 |
tgtaaaacagaaggagatctaaagagttgttggtgatggggttgttgaaagttaggatcttgttgttggagatgtttttgggtggcattggcaagagtgg |
4211675 |
T |
 |
| Q |
119 |
aagtgatgtaaatggtagctatgacaagttgaaggaggaggaagaagatggtgggagtaaaccagctgtagagaccagcccagaatgttggtgatgatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211676 |
aagtgatgtaaatggtagctatgacaagttgaaggaggaggaagaagatggtgggagtaaaccagctgtagagaccagcccagaatgttggtgatgatga |
4211775 |
T |
 |
| Q |
219 |
tgttaatgattgttccaacatgttttaggttttgtgtg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211776 |
tgttaatgattgttccaacatgttttaggttttgtgtg |
4211813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 4211807 - 4211846
Alignment:
| Q |
268 |
ttgtgtgtagggtggaggagattggagagatgaagagagg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211807 |
ttgtgtgtagggtggaggagattggagagatgaagagagg |
4211846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University