View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19119_low_3 (Length: 252)
Name: NF19119_low_3
Description: NF19119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19119_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 64 - 236
Target Start/End: Complemental strand, 24349356 - 24349184
Alignment:
| Q |
64 |
ttcgggttattttctcaacaaggatgctataggatcaatatgtgcattcgggacgagaataatgaatttatgtgcgccaaaacaatattggtaaatgcaa |
163 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24349356 |
ttcgagttatttcctcaacaaggatgctataggatcaatatgtgcattcgggacgagaataatgaatttatgtgcgccaaaacaatattggtaaatgcaa |
24349257 |
T |
 |
| Q |
164 |
atagaactcctcaagaagcgaaagcagtctgtttaccggacgtgctaaattagttacatgagatggatgttta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24349256 |
atagaactcctcaagaagcgaaagcagtctgtttaccggacgtgctaaaatagttacatgagatggatgttta |
24349184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University